circad | circRNAs associated with diseases

hsa_circ_0045272
Gene	ERN1	Organism	Human
Genome Locus	chr17:62130139-62130731:-	Build	hg19
Disease	Systemic Lupus Erythematosus	ICD-10	Drug-induced systemic lupus erythematosus (M32)
DBLink	Link to database	PMID	29700819
Experimental Method
Sample Type	Cells	Comparison	24 patients with SLE and 12 age"�matched healthy volunteers
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCTGAGCGAAGACTGTAAGG Reverse CTGTGAACGATGTTGAGGGA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Li, LJ, Zhu, ZW, Zhao, W, Tao, SS, Li, BZ, Xu, SZ, Wang, JB, Zhang, MY, Wu, J, Leng, RX, Fan, YG, Pan, HF, Ye, DQ (2018). Circular RNA expression profile and potential function of hsa_circ_0045272 in systemic lupus erythematosus. Immunology, 155, 1:137-149.